SGN Marker solcap_snp_sl_2440

SGN-M20694

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71539)
Chromosome
1
Position
97.53 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64294)
Chromosome
1
Position
143.14 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57025)
Chromosome
1
Position
81.87 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTATCCAAATCTGGATCAGCTGAAGCCTCAGCTAAACTCTCCTGCCAAA
  
3' flanking region
GCAAAGCAACGATGATACTATCGATTCTCGAACCTTCTTTGACACAAAAT
SNP nucleotide
TG
SNPdb format
TTTATCCAAATCTGGATCAGCTGAAGCCTCAGCTAAACTCTCCTGCCAAA[T/G]
GCAAAGCAACGATGATACTATCGATTCTCGAACCTTCTTTGACACAAAAT
  
Genomic location of solcap_snp_sl_2440  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20694 marker 20694
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)