SGN Marker solcap_snp_sl_24576

SGN-M20726

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71560)
Chromosome
4
Position
48.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57057)
Chromosome
4
Position
54.28 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACAAAATCAGATGGTCTCAAAATTTTCAATAAAATTCTACTAAATTTGAT
  
3' flanking region
GTATAACAAGAAAAACAGAAAATGGTCGGTTACAACGAGACATCAAACAA
SNP nucleotide
TG
SNPdb format
ACAAAATCAGATGGTCTCAAAATTTTCAATAAAATTCTACTAAATTTGAT[T/G]
GTATAACAAGAAAAACAGAAAATGGTCGGTTACAACGAGACATCAAACAA
  
Genomic location of solcap_snp_sl_24576  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20726 marker 20726
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)