SGN Marker T1532

SGN-M2073
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.03.16.03
Tomato EST read: TPTAZ78TH
Arabidopsis best BAC match: AL035527.1
Arabidopsis position: 4.1120000
Arabidopsis identities: 0.645
Best GenBank protein hit: AAD00695.1
Evalue: 8.7e-44
Identities: 0.596
Description: bifunctional nuclease [Zinnia elegans]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49453)
Chromosome
2
Position
38.13 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47387)
Chromosome
2
Position
78.03 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39666)
Chromosome
2
Position
69.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1532 was used as an overgo probe on plate 10 [well G10]

Plausible BAC Matches:   P243J08,   P273J19,   P300J04,   P089J14

 Overgo Sequences

A sequence
AGATGGGTGGGTTTGAGCTCAAAT
B sequence
GCTACTCCTACAAACCATTTGAGC
AB sequence
AGATGGGTGGGTTTGAGCTCAAATGGTTTG
Marker sequence
TTATTATAATTCTGGGATCTTGAACCACCAAAACAACCCCTAGCTACTGG
TTGAGTAATTTGATTAGAAAAGATGGGTGGGTTTGAGCTCAAATGGTTTG
TAGGAGTAGCTGTTGTTCTGATGATGGTTCAAAATATTCTTGGTTGGGGG
AAAGAGGGACACTATATTATCTGCAAAATTGCTGAGGAATATCTAACAGA
AGATGCTTTGGCTGCAGTCAAAGCATTACTCCCAGATCAAGCCGGAGGTG
ATCTTGCAGCTGTCTGCTCCTGGCCTGATGAGGTTCGGCGCCACTACCAC
TACCGCTGGAGTTCTCCGTTACATTATGTAGATACACCTGATTTTTTGTG
TAATTACAAATATTGCCGAGACTGCCATGACGGGCATGGGCTCAAGGACA
GGTGTGTTACGGGAGCAATATACAACTACTCAATGCAACTTTCGCAGGGA
TATTATGA
Genomic location of T1532  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2073 marker 2073
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)