SGN Marker solcap_snp_sl_24584

SGN-M20734

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71568)
Chromosome
4
Position
48.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67925)
Chromosome
4
Position
56.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64317)
Chromosome
4
Position
66.26 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57065)
Chromosome
4
Position
54.26 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTTACCTAAGGTCACCAGGAAGAGGAAGATTATGGATGACGAGTCTGTT
  
3' flanking region
TGCCCACTACGAAGATGAGTAAGACAGAGGAAAATGTGGTTAGTTCTTTG
SNP nucleotide
AT
SNPdb format
GTTTACCTAAGGTCACCAGGAAGAGGAAGATTATGGATGACGAGTCTGTT[A/T]
TGCCCACTACGAAGATGAGTAAGACAGAGGAAAATGTGGTTAGTTCTTTG
  
Genomic location of solcap_snp_sl_24584  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20734 marker 20734
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)