SGN Marker T1534

SGN-M2074
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.05
Tomato EST read: TPTBA01TH
Arabidopsis best BAC match: AL049658.1
Arabidopsis position: 3.1120000
Arabidopsis identities: 0.826
Best GenBank protein hit: CAA71003.1
Evalue: 7e-115
Identities: 0.916
Description: aldehyde dehydrogenase (NAD+) [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39667)
Chromosome
5
Position
0.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1534 was used as an overgo probe on plate 1 [well C3]

Plausible BAC Matches:   P189D16,   P224O20,   P164P03,   P150A22,   P311B03,   P200H07,   P166L20,   P087A23,   P045M24,   P153M09,   P257J12,   P229G12,   P204F12,   P271H15,   P221L21,   P152C18,   P166D06,   P296M20

 Non-Plausible BAC matches

P119O17,   P107O24,   P243M11,   P018A13,   P017F18,   P308M12,   P018E12,   P316H03,   P313A09,   P010D07,   P017C23

 Overgo Sequences

A sequence
AATTGCAACGCTCGAGACTTGGGA
B sequence
ATAAGGCTTCCCAGTGTCCCAAGT
AB sequence
AATTGCAACGCTCGAGACTTGGGACACTGG
Marker sequence
GATCCCATCTTGGCAATATAGCTGCTTATAAATACAGCACAGCGGCTGCT
CTCGAGGAGCCCATCAAGCCTACTGTCAATGTGGATCATACTAAACTTCT
TATCAACGGGCAGTTTGTTGATTCTGCATCAGGAAAAACTTTCCCGACTC
TCGACCCCAGGACAGGGGAGGTAATTGCACATATTGCTGAAGGTGATGCA
GAAGATATTAATCGGGCAGTTGCTGCTGCTCGTAAGGCTTTCGATGAAGG
ACCATGGCCTAGGATGACTGCTTATGAAAGGTCAAAGATATTGCTGCGCC
TTGCTGATCTGATTGAAAAACATAACGATCAAATTGCAACGCTCGAGACT
TGGGACACTGGGAAGCCTTATGCACAAGCTGCTAAGATTGAAGTACCAAT
GGTTGTACGTCTACTCCGNTATTATGCTGGCTGGGCAGATAAAATTCATG
GTATGACCATTCCTGCCGATGGACCATATCATGTTCAAACGTTGCATGAA
CCGATCGGGGTTGCTGGTCAGATTATCCCATGGAATTNTCCTCTCCTCAT
GTTTTCTTGGAAGATTGGCCCTGCTTTAGCTTGTGGTAACACAATTGTGC
TAAAGACGGCTGAGCAGACCCCATGATCTGCATTGTATGTAGCAAATCTA
TTT
Genomic location of T1534  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2074 marker 2074
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)