SGN Marker T1535

SGN-M2075
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.06.1.05
Tomato EST read: TPTBA07TH
Arabidopsis best BAC match: AC011915.3
Arabidopsis position: 1.1334000
Arabidopsis identities: 0.754
Best GenBank protein hit: AAF16606.1
Evalue: 4.7e-45
Identities: 0.754
Description: very-long-chain fatty acid condensing enzyme (CUT1); [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39668)
Chromosome
2
Position
89.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1535 was used as an overgo probe on plate 11 [well D5]

Plausible BAC Matches:   P212J15,   P265D03,   P164H08,   P033E18

 Overgo Sequences

A sequence
TGGCTGCTCTTGTTATTCAGGTAC
B sequence
TCAGGGCCTAATTTTAGTACCTGA
AB sequence
TGGCTGCTCTTGTTATTCAGGTACTAAAAT
Marker sequence
TCTAACTCTGTTAAGCTGAAATATGTGAAACTTGGTTACCAATACCTTGT
TAATAATTTTCTTACTTTCTTGATTGTTCCCATAATGGCTGCTCTTGTTA
TTCAGGTACTAAAATTAGGCCCTGAAGAGATTGTAAGTATTTGGAATTCA
CTTCACTTTGATCTCCTCCAAATCCTCTGTTCTTCTTTTCTCATCATTTT
CATAGCCACAGTTTACTTCATGTCAAAACCAAGATCCATTTACTTAGTAG
ATTACTCATGTTACAAAGCCCCCGTTACGGGCAGAGTACCCTTTTCAACT
TTCATGGAACATTCGCGGT
Genomic location of T1535  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2075 marker 2075
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)