SGN Marker solcap_snp_sl_24604

SGN-M20752

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71581)
Chromosome
4
Position
48.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67930)
Chromosome
4
Position
56.30 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57083)
Chromosome
4
Position
54.20 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGTGACTCAAAGCAGTAATAATCTCAATTTCCAAAACAAACTCTCGCAC
  
3' flanking region
GCATCTTCGGATTGTTTTAAGATCTTCACAGCAAGTTCTTTGCCATCAGG
SNP nucleotide
AT
SNPdb format
TTGTGACTCAAAGCAGTAATAATCTCAATTTCCAAAACAAACTCTCGCAC[A/T]
GCATCTTCGGATTGTTTTAAGATCTTCACAGCAAGTTCTTTGCCATCAGG
  
Genomic location of solcap_snp_sl_24604  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20752 marker 20752
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)