SGN Marker solcap_snp_sl_24606

SGN-M20754

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71582)
Chromosome
4
Position
48.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64325)
Chromosome
4
Position
69.63 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57085)
Chromosome
4
Position
54.19 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTGTGTCATTTTTTTTTCTAACACTATACTAGTCTTTTTGCCGCCGGCGG
  
3' flanking region
ATGAGTTTATTCAGGTAAAAGGGAAAAGGGTATTCATATATAAGCCTAAA
SNP nucleotide
TG
SNPdb format
CTGTGTCATTTTTTTTTCTAACACTATACTAGTCTTTTTGCCGCCGGCGG[T/G]
ATGAGTTTATTCAGGTAAAAGGGAAAAGGGTATTCATATATAAGCCTAAA
  
Genomic location of solcap_snp_sl_24606  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20754 marker 20754
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)