SGN Marker T1536

SGN-M2076
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTBA19TH
Arabidopsis best BAC match: AB023046.1
Arabidopsis position: 3.0360000
Arabidopsis identities: 0.822
Best GenBank protein hit: BAB01260.1
Evalue: 8.3e-88
Identities: 0.813
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39669)
Chromosome
3
Position
151.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1536 was used as an overgo probe on plate 2 [well C2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GATTGAGAGTGGTGCATTCAAGGG
B sequence
GACCCAAGTTGAGTGTCCCTTGAA
AB sequence
GATTGAGAGTGGTGCATTCAAGGGACACTC
Marker sequence
GTAAAACCAGAGTTGATGATTGAGAGTGGTGCATTCAAGGGACACTCAAC
TTGGGTCTTGAGACAAGCAATGCCAGATACACGAATCATCTCACTTACAC
CCCGTCATCCTGAGAAGTATCTAAAGAAAGGGCCTGCCTACGTTGATGAG
AATTGCACATACTTTGCTGGTAAAGACTTTGTTGATTTTGGAAATGTTGA
TTGGGGGAAAGTTATGAAGAAGCATGGGATCAAGGATCGTAGCCAGGGTC
TTGTCTTTTTTGATGATCATCAAAATGAATTGAAAAGACTGAAGCCAGCA
CTAAAAGCTGGGTTTAGGCATCTTGTGTTTGAGGACAATTATGATACTGG
TACAGGAGACCACTACTCTTTCAAGCAAATGTGCGATCAATTTTATATTA
GAGGTGGAGGCCATAGCTGCTTTAAGGACAGTGATGAAGGAAGGATCAGA
GCAAGAAGGAAGAAATTCTGGGAGAAGGCTTGTGACATTGATGAACTTTG
CGGTCCTGGTGAAACTAGGTGGGGTGTGAGA
Genomic location of T1536  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2076 marker 2076
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)