SGN Marker solcap_snp_sl_24613

SGN-M20761

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71586)
Chromosome
4
Position
47.29 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64329)
Chromosome
4
Position
67.60 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57092)
Chromosome
4
Position
54.06 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTAGGTTCCACAATATTTTCTGGACTACAAATGTGTCATCAGATGGTGGG
  
3' flanking region
TTGAAGAACCATTAACAAAGTGTTGTGGTTCAGAAATGGACGATTTTGGG
SNP nucleotide
CG
SNPdb format
TTAGGTTCCACAATATTTTCTGGACTACAAATGTGTCATCAGATGGTGGG[C/G]
TTGAAGAACCATTAACAAAGTGTTGTGGTTCAGAAATGGACGATTTTGGG
  
Genomic location of solcap_snp_sl_24613  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20761 marker 20761
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)