SGN Marker solcap_snp_sl_24644

SGN-M20766

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67936)
Chromosome
4
Position
58.21 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64331)
Chromosome
4
Position
76.44 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57097)
Chromosome
4
Position
54.59 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTTAGGAGGAGAGAAAGAGGGTTTTAGCAAATGAATATTGGATGTCATC
  
3' flanking region
TCTTCGATTAGCTCATCCGTCCTCTTCTCTTATCTTTTCTTCTTCTCAAT
SNP nucleotide
TC
SNPdb format
TTTTAGGAGGAGAGAAAGAGGGTTTTAGCAAATGAATATTGGATGTCATC[T/C]
TCTTCGATTAGCTCATCCGTCCTCTTCTCTTATCTTTTCTTCTTCTCAAT
  
Genomic location of solcap_snp_sl_24644  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20766 marker 20766
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)