SGN Marker T1537

SGN-M2077
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTBA25TH
Arabidopsis best BAC match: AC002131.1
Arabidopsis position: 1.0370000
Arabidopsis identities: 0.710
Best GenBank protein hit: AAC17619.1
Evalue: 1.2e-52
Identities: 0.617
Description: Contains similarity to NFATc3 gb|U28807 from Mus musculus. [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39670)
Chromosome
2
Position
74.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1537 was used as an overgo probe on plate 1 [well B1]

Plausible BAC Matches:   P248I05,   P320D04

 Overgo Sequences

A sequence
TATGCACTGGTGGACAGCTTCAAC
B sequence
CCAGAAGGGGTTCTAAGTTGAAGC
AB sequence
TATGCACTGGTGGACAGCTTCAACTTAGAA
Marker sequence
GTGAAAGGTATTATAAAGCAAATTCCAACAGCAAAGATTCTCCATAAACA
CTTTCCTAATGCTACAGTTTTCCTTAACTATACAAAATCTTGGTAGAGAA
AATCTTGAAGCAAATCTCACATGGCCATTTCAAATTTGTCCATTTTTATT
ATTTTCCTTGTACTTCAATTTCTATGCATAACAGAAGCTCAATCAAGCAT
TTGTAGAAATTCGTGTGGCGATATCCCAATTCAGTATCCTTTTGGCATTG
ATGATGGCTGTGGAAGTCCATTTTATCGACACATTCTTGTATGCACTGGT
GGACAGCTTCAACTTAGAACCCCTTCTGGTAGATATCCTGTTAGAAATTT
AAGTTATATGGATCCACATATTCTTGTGACCGATCCCTTAATGTGGAATT
GTCTAGATGGTGACAATTTTCGACCTACCAGGCGCGTTAGTCTAGATACT
AGCACACATTTCACTGTGTCCTCTGAAAATGACTACTTGTTCTTTAATTG
TAGAGAAAGTGATGTGTTAGTTGAGCCAAAACCAATGTTCTGCGAGCGTT
TCC
Genomic location of T1537  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2077 marker 2077
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)