SGN Marker solcap_snp_sl_24654

SGN-M20772

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57103)
Chromosome
4
Position
54.49 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CGAATATTTTGGGGCAGTATTCAGGCAGTTCTGCTGATTTTCTAGTCAAT
  
3' flanking region
CAAAGAGAGGAGAAGATGAAACATTCCAGGGAGAGAAACGGTTCAGAAGG
SNP nucleotide
AG
SNPdb format
CGAATATTTTGGGGCAGTATTCAGGCAGTTCTGCTGATTTTCTAGTCAAT[A/G]
CAAAGAGAGGAGAAGATGAAACATTCCAGGGAGAGAAACGGTTCAGAAGG
  
Genomic location of solcap_snp_sl_24654  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20772 marker 20772
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)