Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_24655

SGN-M20773

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67939)
Chromosome
4
Position
56.93 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64334)
Chromosome
4
Position
75.77 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57104)
Chromosome
4
Position
54.49 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATAACACTTCAGGCATGTTTGCACAAAGCTCCAGCAGATGCATCTGCACG
  
3' flanking region
GGAGCAAAGTGGCCAGCAAAATGGCCTTTGAGGTCGGAGAAGCTTCCTTA
SNP nucleotide
AT
SNPdb format
ATAACACTTCAGGCATGTTTGCACAAAGCTCCAGCAGATGCATCTGCACG[A/T]
GGAGCAAAGTGGCCAGCAAAATGGCCTTTGAGGTCGGAGAAGCTTCCTTA
  
Genomic location of solcap_snp_sl_24655  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20773 marker 20773
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)