SGN Marker solcap_snp_sl_24679

SGN-M20781

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71596)
Chromosome
10
Position
42.73 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67941)
Chromosome
10
Position
50.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57112)
Chromosome
10
Position
60.36 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTCCCTTTTATCACTTGCTATTTGATTTCACCTTGAAATTCTATTAAACA
  
3' flanking region
CGGAACCCTAAAAACCCTTTTCTGCCACCATTACCGCCGCATCGCCGCCA
SNP nucleotide
AG
SNPdb format
CTCCCTTTTATCACTTGCTATTTGATTTCACCTTGAAATTCTATTAAACA[A/G]
CGGAACCCTAAAAACCCTTTTCTGCCACCATTACCGCCGCATCGCCGCCA
  
Genomic location of solcap_snp_sl_24679  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20781 marker 20781
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)