SGN Marker solcap_snp_sl_24799

SGN-M20792

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71599)
Chromosome
1
Position
3.32 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67944)
Chromosome
1
Position
9.77 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64338)
Chromosome
1
Position
14.76 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57123)
Chromosome
1
Position
0.67 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCAAGGTTTGAATGTGAAGAAAGCAACTCTGCAACCAGTATCCACACCTC
  
3' flanking region
ACAATCTACTCTACTTTTATCGTCAAAACTGGAATGGCTGATGCTGCTGC
SNP nucleotide
TG
SNPdb format
TCAAGGTTTGAATGTGAAGAAAGCAACTCTGCAACCAGTATCCACACCTC[T/G]
ACAATCTACTCTACTTTTATCGTCAAAACTGGAATGGCTGATGCTGCTGC
  
Genomic location of solcap_snp_sl_24799  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20792 marker 20792
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)