SGN Marker T1541

SGN-M2080
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TPTBA93TH
Arabidopsis best BAC match: Z97341.2
Arabidopsis position: 4.0900000
Arabidopsis identities: 0.666
Best GenBank protein hit: CAA07370.1
Evalue: 1.2e-24
Identities: 0.816
Description: proline-rich protein [Capsicum annuum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39672)
Chromosome
5
Position
107.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1541 was used as an overgo probe on plate 11 [well F8]

Plausible BAC Matches:   P076O15,   P168B11,   P171M23,   P146F07,   P274P10,   P064N12,   P161C23,   P099F09,   P198C19,   P101L08,   P040C21,   P026N03

 Overgo Sequences

A sequence
CCTAAAGTAGTGGTCGTGGAGAAG
B sequence
TCTCCGGTTCTTTAGGCTTCTCCA
AB sequence
CCTAAAGTAGTGGTCGTGGAGAAGCCTAAA
Marker sequence
CTATAGATTATTTTATCACTTTCAAATATCAAAATTCTTAGTTCTCAACT
ATGGGTGGTGACAATACTGAGAAGATTACCATAATGATGCTAAAGGTTGA
TCTTCAATGTTCAAGCTGCTACAAACAAGTCAAAAAAATTCTCTGCAAAT
TCCCTCAAATTCGAGACCAAGTGTATGATGAAAAGGCCAATATTATCACA
ATTACTGTATTGTGTTGCAATCCTGAAAAAATTCGTGACAAATTGTGTTG
CAAAGGAGGGGGAGTAATCAAGAGCATTGAGATCAAAGAGTCTCAAAAGC
CTAAAGAACCGGAAAAGCCCAAAAAGCCTGAAAAGCCCGAGAAATCGAAA
GTGGTGGTGGTGGAGAAGCCTAAAGAGCCCGAAAAACCTAAAGTAGTGGT
CGTGGAGAAGCCTAAAGAACCGGAGAAACCCAAAGTGGTGGTTGCAGAGA
AGCCTAAAGAATCAG
Genomic location of T1541  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2080 marker 2080
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)