SGN Marker solcap_snp_sl_24969

SGN-M20805

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57136)
Chromosome
11
Position
6.50 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCCAACCCTGTCATAGGAAAGTTACCCAACCCTGTCATAGGGAAGCTACC
  
3' flanking region
AACCCTGTCATAGGAAAGGGGCTTCTCTCTCCATCAGGTAGAAGCCCATT
SNP nucleotide
CG
SNPdb format
CCCAACCCTGTCATAGGAAAGTTACCCAACCCTGTCATAGGGAAGCTACC[C/G]
AACCCTGTCATAGGAAAGGGGCTTCTCTCTCCATCAGGTAGAAGCCCATT
  
Genomic location of solcap_snp_sl_24969  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20805 marker 20805
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)