SGN Marker solcap_snp_sl_24987

SGN-M20823

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71620)
Chromosome
11
Position
45.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67956)
Chromosome
11
Position
48.10 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64349)
Chromosome
11
Position
46.63 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57154)
Chromosome
11
Position
7.15 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTATGGCTATCTACACGAGTTATCTTATGAATCTGCTTTCTTGTGTTATT
  
3' flanking region
CAGTGTTTGCTTCATTTGAACCTTACTGAGAGATAAGTAGTTGCAACACA
SNP nucleotide
CG
SNPdb format
GTATGGCTATCTACACGAGTTATCTTATGAATCTGCTTTCTTGTGTTATT[C/G]
CAGTGTTTGCTTCATTTGAACCTTACTGAGAGATAAGTAGTTGCAACACA
  
Genomic location of solcap_snp_sl_24987  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20823 marker 20823
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)