SGN Marker solcap_snp_sl_25001

SGN-M20832

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71622)
Chromosome
10
Position
27.30 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67961)
Chromosome
10
Position
35.08 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64354)
Chromosome
10
Position
43.01 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57163)
Chromosome
10
Position
4.14 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAGATCCTTTAGCTGAGAAAGCAGTGCAGGAGATCAAGAAACAGTACGCT
  
3' flanking region
TCTTTGATGCCAAAGTTTTGAGTAAAATTCCCATAGGGCCATTAAAAGAT
SNP nucleotide
AG
SNPdb format
TAGATCCTTTAGCTGAGAAAGCAGTGCAGGAGATCAAGAAACAGTACGCT[A/G]
TCTTTGATGCCAAAGTTTTGAGTAAAATTCCCATAGGGCCATTAAAAGAT
  
Genomic location of solcap_snp_sl_25001  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20832 marker 20832
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)