SGN Marker solcap_snp_sl_25082

SGN-M20842

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71625)
Chromosome
4
Position
24.48 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67963)
Chromosome
4
Position
36.89 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64357)
Chromosome
4
Position
36.82 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57173)
Chromosome
4
Position
3.50 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTTTGCAAAATGCCGAAACACCTGTTAATGCTGCCTCTAGTAAAGATAT
  
3' flanking region
ACAAATTTTGGAAGCAAGAGCCGTATAATCAGCTTACCTCGTGCATCCAA
SNP nucleotide
CG
SNPdb format
TCTTTGCAAAATGCCGAAACACCTGTTAATGCTGCCTCTAGTAAAGATAT[C/G]
ACAAATTTTGGAAGCAAGAGCCGTATAATCAGCTTACCTCGTGCATCCAA
  
Genomic location of solcap_snp_sl_25082  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20842 marker 20842
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)