SGN Marker T1549

SGN-M2088
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTBB54TH
Arabidopsis best BAC match: AC002409.2
Arabidopsis position: 2.2220000
Arabidopsis identities: 0.828
Best GenBank protein hit: AAB86444.1
Evalue: 9.0e-39
Identities: 0.811
Description: 4-alpha-glucanotransferase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39674)
Chromosome
2
Position
2.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1549 was used as an overgo probe on plate 11 [well A3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTGCCTTGCACCCATTGTACCTAC
B sequence
AAAATGGCCTCTACCCGTAGGTAC
AB sequence
TTGCCTTGCACCCATTGTACCTACGGGTAG
Marker sequence
GGTTCAGCTATTCTGCAATTTATAATCTGCTGCCCCTATTTAGAGGAAGG
AACATCTATTTATGTGCTTGGCAGCTCCTTAAATCTTGGGCAATGGAAGA
TTCAGGATGGCCTTAAGCTCGCATATGCTGGGGATTCATTATGGCAGGCA
GCCTGCGTTATGGGAAAAGATGACTTCCCTTTAAAATACAAGTACTGCAA
ACATAGTAAGGCTGGAACATCAGTGGAATGTGGTGCCAGTCGCGAGATTT
CTGTTGATGTCACAATAGGTGAATCTAAATTTGTAGTTCTTTCACATGGC
TTAAAGCGGGAAATGCCATGGAGGGGAGCAGGTGTCTCAATACCCATGTT
TCCCGTACGGTCAGAGGCTGATCTTGGAGTTGGGGAGTTTCTTGACCTGA
AGTTACTTGTACATTGGGCCGTTGAATCTGGCTTTCATTTGGTTCAGCTT
TTGCCCATCAATGATACATCAGTCAACTGTATGTGGTGGGATTCTTACCC
TTATAGCTCACTCTCAGTATTTGCCTTGCACCCATTGTACCTACGGGTAG
AGGCCATTTTATCGAACATTCCAGAGGATATCAA
Genomic location of T1549  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2088 marker 2088
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)