SGN Marker T1557

SGN-M2094
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.01.10
Tomato EST read: TPTBB93TH
Arabidopsis best BAC match: AC007197.5
Arabidopsis position: 2.0810000
Arabidopsis identities: 0.851
Best GenBank protein hit: AAD25855.1
Evalue: 6.5e-74
Identities: 0.751
Description: putative methylmalonate semi-aldehyde dehydrogenase [Arabidopsis thaliana]
Comment: involved in valine catabolism
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49457)
Chromosome
1
Position
85.83 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47391)
Chromosome
1
Position
128.45 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39679)
Chromosome
1
Position
140.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1557 was used as an overgo probe on plate 9 [well F7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCTACGGAATCCTCATGGAAGCAT
B sequence
CTCTGATGGAAGTTCGATGCTTCC
AB sequence
GCTACGGAATCCTCATGGAAGCATCGAACT
Marker sequence
GAACTAGTCTCGAGTTTTCAGTTCACAGAGTGAAGAAACTAAGGTCTTTG
ACTCCTGGTATTTTTGCTCTTGCTAATCATCACTTTTCAGTTGCTACGGA
ATCCTCATGGAAGCATCGAACTTCCATCAGAGTTCCAAATTTAATTGGTG
GCAGCTTTGTAGATTCAGAATCATCAGAATTCGTTGATGTTATAAACCCA
GCAACCCAAGAGGTGGTTTCTCAGATACCTTTAACAACGGATAAAGAATT
CAAATCTGCGGTTTCTGCAGCCAAGGAGGCTTTTCCGTCATGGAAAAACA
CACCCATAACCACAAGACAACGGGTCATGCTCAAATTCCAAGAGCTTATT
AGGAAGAACATGGATAAGCTTGCCTTCAATGTGACTACGGAGCAGGGAAA
AACACTGTAAGATGCACAAGGGGATGTGTTCCGCGGTCTTGAGGTGGTGG
AGCATGCGTGTGGAATGGCAACTTTGCAGATGGGTGAGTATGGGTCTAAT
GTATCAAAAGGAATTGATACCTATAGCCTAAGGGAACCTCTGGGTGTTTG
CGCCCGGATTTGTCCATTCAACTTCCCTGCAA
Genomic location of T1557  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2094 marker 2094
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)