SGN Marker T1560

SGN-M2096
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTBC06TH
Arabidopsis best BAC match: AC013430.5
Arabidopsis position: 1.1496000
Arabidopsis identities: 0.544
Best GenBank protein hit: AAF18557.1
Evalue: 2.0e-42
Identities: 0.584
Description: unknown protein; 65290-67280 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39682)
Chromosome
4
Position
83.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1560 was used as an overgo probe on plate 7 [well F1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCTGGTTCGTTCATTGCAGAATCC
B sequence
TCCGCCCTTTGTTCAAGGATTCTG
AB sequence
CCTGGTTCGTTCATTGCAGAATCCTTGAAC
Marker sequence
GCACGAGGAGCAACTTGGGATCTCCTGGTTCGTTCATTGCAGAATCCTTG
AACAAAGGGCGGAATGACAAGGGCAAGGAGGTTTTGGATGAATTCCGAGG
AGTAAGCGGATTTTGGCCACAGAACCAGTGGGTTGCTTTCCCTGAAGAAT
CCTCTAGGTTTATGAGAATCAATGAATGGGTGAATGAACTTCCCAGTCAT
CCACCATGCTTAATTGATGAACATGATCATGTTGAAGATGAGGTTGATAT
CTCGCCTTCGCCCGATGCTTGTAAATCACCTCTCATTAGCCCATATCCAA
ATATAAATGTCCCAGAAGAGGTTGCACATGCTAATACAGTCATCCGATCT
CTTAATTCTTCCTCAACGGTTGCTCACATTGCGAGCGCTGGTCTGAAAGT
TATCCCTGCTATATCACACTTATGTAGCCTTCGATCTGTCAATCTATCAG
GCAACTTTATAGTTCAAATAACTCCGGGATCACTACCAAAGGGTCTTCAT
GTTCTCAATTTATCAAGGAACAAGATCCACACAATTGAAGGACTGAGGGA
ATTGACACGTCTGCGCTTGCTTGACCTAAGTTACAACAGAATCTCTCGAA
TTGGACAAGGTTTGTCGAGTTGTACTCTCATCAAA
Genomic location of T1560  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2096 marker 2096
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)