SGN Marker T1563

SGN-M2098
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTBC32TH
Arabidopsis best BAC match: AC009991.3
Arabidopsis position: 3.0150000
Arabidopsis identities: 0.791
Best GenBank protein hit: AAF01527.1
Evalue: 7.4e-65
Identities: 0.652
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39683)
Chromosome
6
Position
16.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1563 was used as an overgo probe on plate 2 [well A12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGAAGTTGCACCATGGGAGCTCTC
B sequence
AGCAGGTAGAGTTCCAGAGAGCTC
AB sequence
AGAAGTTGCACCATGGGAGCTCTCTGGAAC
Marker sequence
GGAAGAAGTTGCACCATGGGAGCTCTCTGGAACTCTACCTGCTTCTCCCC
AGTTCAAAATAATCCATTTTTATTCTCTCGTTCAAGCAAGAAATATGCAA
ATTCCTTGTGGAACTTCACCTACAAATCCTTCCAGATTTCTTGCAGCGAA
GTTAAAGAAAACCATGGTAGATCCAGTAGTAATAGGAAGATGGAGGAATA
CAACTTAGCTATGAAGAGAATGATGAGGAATCCTTATGAATATCACCATG
AACTTGGAATGAACTACACATTGATAACAGAAGATCTAATTGTTGGCTCC
CAGCCTCAAAAAATCGAAGATATAGATCATTTGAAGGAAGAGGAGAACGT
TTCTTTTATACTAAACTTGCAGCAGGACAAAGATATTGAGTTTTGGGGGA
TAGACCTCCAGTCTATAGTTACAAGATGTTCAGAGCTTGGAATTAATCAC
ATGAGAAGGCCTGCAAGAGATTNTGATCCAGATTCCTTGAGGAGTGTATT
ACCTAAAGCTGTTTCATCACTGGAGTGGGCGATTTCAGAAGGAAAAGGAA
GAGTGTATGTACATTGCACTGCTGGATTGGGAAGGGCCCCTGCTG
Genomic location of T1563  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2098 marker 2098
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)