SGN Marker T1564

SGN-M2099
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 5.04
Tomato EST read: TPTBC34TH
Arabidopsis best BAC match: AL132958.1
Arabidopsis position: 3.1183000
Arabidopsis identities: 0.794
Best GenBank protein hit: CAB64214.1
Evalue: 5.4e-70
Identities: 0.638
Description: RNA helicase-like protein [Arabidopsis thaliana]
Comment: similarity to yeast RNA helicase
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39684)
Chromosome
4
Position
133.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1564 was used as an overgo probe on plate 7 [well D1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GATCGATCAAGCTGAGCAGTCTTC
B sequence
GTCCTCATTAGAAGCGGAAGACTG
AB sequence
GATCGATCAAGCTGAGCAGTCTTCCGCTTC
Marker sequence
GGCCGCTTCTACGACAGCAAACCCACCCGAATCCAAAAGTTGGGCAGACC
AAGCCGACGAGATCGATCAAGCTGAGCAGTCTTCCGCTTCTAATGAGGAC
GCTGCTGCCGAGATAAATATCGGATCTCTACAAGTCGATGAGTCCAAAAG
AGACAACTCCACTCTCTCTGATCCGGAAGATTCCAGCATAGAAGCGGTTA
CGTCTGGCGATACTATGTACAAATCAGCGAAGAGATTTGAGGATTTGAAC
TTATCTCCTGAGCTATTGAAGGGATTATATGTACAAATGCAGTTTGAGCG
TCCTAGCAAGATTCAGGAAATTAGTTTGCCTATGATTCTTACGCCTCCGT
ACAAGAATCTTATTGCTCAGGCTCATAACGGTTCTGGTAAAACTACTTGC
TTTGTGCTTGGGATGTTGAGTCGAATTGATCCAAAGCTTGCTGCCCCTCA
AGCTCTCTGTATCTGTCCAACCAGAGAATTGGCTATTCAGAATATGGAAG
TGCTATTGAAGATGGTGAAGTTCACTGGCATAACATCAGAGTTAGGTATC
CCAGCAGATTCTGCCAACTATATTCCAATCTCAAAACGTCCGCCTGTTAC
GGCACAAGTAGTGATTGGCACACCTGGGACTATAAACAAGTGGGTGAC
Genomic location of T1564  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2099 marker 2099
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)