SGN Marker solcap_snp_sl_25693

SGN-M21062

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71682)
Chromosome
4
Position
60.85 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68057)
Chromosome
4
Position
68.31 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64452)
Chromosome
4
Position
98.92 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57393)
Chromosome
4
Position
57.71 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAGCTTCCAGCTCCCTTCCGGATTGGTGACTGCTTACCACCATCGGCTGT
  
3' flanking region
TTCTCGCCCTGTGATGACTTCTTGAACAGCATGAAGTTCCGAACTCCAAG
SNP nucleotide
TG
SNPdb format
CAGCTTCCAGCTCCCTTCCGGATTGGTGACTGCTTACCACCATCGGCTGT[T/G]
TTCTCGCCCTGTGATGACTTCTTGAACAGCATGAAGTTCCGAACTCCAAG
  
Genomic location of solcap_snp_sl_25693  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21062 marker 21062
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)