SGN Marker T1583

SGN-M2111
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTBD87TH
Arabidopsis best BAC match: AB011479.1
Arabidopsis position: 5.2890000
Arabidopsis identities: 0.789
Best GenBank protein hit: BAB11551.1
Evalue: 1.4e-34
Identities: 0.756
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39692)
Chromosome
5
Position
74.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1583 was used as an overgo probe on plate 11 [well G10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACCGATCACTTCCTTCTGATCGTC
B sequence
CGGAAAAGTGATCGGAGACGATCA
AB sequence
ACCGATCACTTCCTTCTGATCGTCTCCGAT
Marker sequence
GGTCACCGATCACTTCCTTCTGATCGTCTCCGATCACTTTTCCGACCACT
TCATACTAATTCCGATTCATTATACAGAATCTGTATTAGAAAAACGTAAA
AATGTGGGTGTTTTATCTGATCTCATTGCCTTTAACCCTAGGCATGGTGA
TTTGGACTCTAAAGTACTTTTCTGGTCCAGAAGTGCCTCGTTACGTGTTC
TTCACAGTTGGTTATACCTGGTTTTGCTCTATCTCCATTATTATCCTTGT
GCCTGCCGATATTTGGACGACAATAGTTGGGAGTGATAATGGAGGCATAT
CATTCTTTTGGAGCTGGTCATACTGGAGTACATTCCTACTCACATGGCTT
GGTGTTCCCCTCATTCAAGGGTTTGAAGATGCTGGAGACTTTACACTTGT
AGAGCGATTGAAGACTAGCATACA
Genomic location of T1583  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2111 marker 2111
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)