SGN Marker solcap_snp_sl_26254

SGN-M21148

Synonyms  
SGN-U585636_snp200
SGN-U585636_snp200_solcap_snp_sl_26254
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70478)
Chromosome
1
Position
71.71 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67007)
Chromosome
1
Position
47.92 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63481)
Chromosome
1
Position
74.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57479)
Chromosome
1
Position
75.34 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATCAATGGCCGATTTCAACCACAGAAGATCTCTGTTTTCCACGGACTCAC
  
3' flanking region
CGGCCAAATATCTCAATTCAGAGCTATTTAGAGAGGATTTTCAAGTACGC
SNP nucleotide
AG
SNPdb format
ATCAATGGCCGATTTCAACCACAGAAGATCTCTGTTTTCCACGGACTCAC[A/G]
CGGCCAAATATCTCAATTCAGAGCTATTTAGAGAGGATTTTCAAGTACGC
  
Genomic location of solcap_snp_sl_26254  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21148 marker 21148
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)