SGN Marker T1592

SGN-M2117
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTBF48TH
Arabidopsis best BAC match: AC010675.4
Arabidopsis position: 1.1354000
Arabidopsis identities: 0.638
Best GenBank protein hit: AAF07390.1
Evalue: 1.7e-10
Identities: 0.604
Description: putative alpha-amylase; 60344-64829 [Arabidopsis
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49462)
Chromosome
5
Position
1.65 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47396)
Chromosome
5
Position
17.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39698)
Chromosome
5
Position
16.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1592 was used as an overgo probe on plate 11 [well H1]

Plausible BAC Matches:   P058L13

 Non-Plausible BAC matches

P076K23,   P176G21,   P024H21

 Overgo Sequences

A sequence
TTGGAACCTCACTGTGGGATGTAG
B sequence
CCATTTCCCTGGCAAACTACATCC
AB sequence
TTGGAACCTCACTGTGGGATGTAGTTTGCC
Marker sequence
GGCCGGCGATGCCCATTGTCTATATCCAAATCAGAAGAAAACCTCTCATT
TTTCTCTAAATTACTCCAGGAGGCCACTCTCCGGTACCGCAACTTTGAGA
TTCTGCGATTATCGGCGTCGCCGGACGGTACCTATCAGGGCTAGTTCCAC
CGATGCTGTCGTCATTGAGACGTCGGAGCAGTCGGACGTAGTTTTTAAGG
AGACTTTCTCGTTGAAACGACCGGAAAGGGCTGAAGGAAAGATATCCATC
AGATTGGATAAGGGGAAGGATGAAGAGAATTGGAACCTCACTGTGGGATG
TAGTTTGCCAGGGAAATGGATCCTTCACTGGGGGGTCCATTATACAGATG
ACACTGGCAGTGAATGGGATCAACCTCCTCCAGAGATGCGGCCGTCAGGT
TCAATTGCCATAAAGGATTATGCAATTGAAACTTCTTTTGCAGGGAGACA
CATTCCAAGAGGTGAAGATCGACATAAGTTCTAAGTGGTCTATAGCAGCT
ATAAATCTTGTGTTGAAAGATGAGGAAACTGGAGTTTGGTATCAGCACAG
AGGGCCGGACTTCAAGATTC
Genomic location of T1592  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2117 marker 2117
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)