SGN Marker solcap_snp_sl_26448

SGN-M21180

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68097)
Chromosome
10
Position
42.97 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64493)
Chromosome
10
Position
68.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57511)
Chromosome
10
Position
58.21 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTAGACTTTGGATAAGCAACACAAGTGAGCACAAATCCTTCATCTATTTG
  
3' flanking region
TCATCATCAAGAAAACTGTTATCAGACTGATCAACACTTCCAGCAGTAAC
SNP nucleotide
TG
SNPdb format
TTAGACTTTGGATAAGCAACACAAGTGAGCACAAATCCTTCATCTATTTG[T/G]
TCATCATCAAGAAAACTGTTATCAGACTGATCAACACTTCCAGCAGTAAC
  
Genomic location of solcap_snp_sl_26448  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21180 marker 21180
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)