SGN Marker solcap_snp_sl_2671

SGN-M21198

Synonyms  
SL1_00sc6004_1750754
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71743)
Chromosome
11
Position
82.51 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68102)
Chromosome
11
Position
85.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64499)
Chromosome
11
Position
100.67 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57529)
Chromosome
11
Position
51.94 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATACTAGAGGGAGGTATATGGCCTATTGTCCAGGTGGCCAACTTCCGCTA
  
3' flanking region
ATACCAGTTAGGTATCAGCTCCTTTACGTCAATTTCTTCTGCTTGCTTGA
SNP nucleotide
TC
SNPdb format
ATACTAGAGGGAGGTATATGGCCTATTGTCCAGGTGGCCAACTTCCGCTA[T/C]
ATACCAGTTAGGTATCAGCTCCTTTACGTCAATTTCTTCTGCTTGCTTGA
  
Genomic location of solcap_snp_sl_2671  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21198 marker 21198
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)