SGN Marker CT182

SGN-M212

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
500
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
TTTTTTTTTTTTTTTTTTTTTTTTTTGAAGGAACAAGTTACTCTAATATAGTCATTTCATTTGTATTGTAGCAATGGTTCCATTAAACAA
AACAAGCAAAATTGTTCGTTTATTTAAAGAGACACAATTTTACATTCACTACAAACATACTTGCTGCAGACTCCGCGACATCGAATTGGC
ACTAGCAGCTCCTCTATATATCCTCAGGTCCATTGATGTCCTTGTTTGCAATCACAGCACCATCTGGAATTTCTAGCTTCACTCCGGATT
TGGCTGCAACAGTCACTTTCCCCTTTAGGGTAACGCTAGATCCAAACCATACATCACCGGTCACCTTCAAGCTACCTAGATCAATGATGC
TGGGAATGGACTTGAAACGGCCTAAGAAGTTGGCCACCTTCTT
Reverse sequence
AAGAAGGTGGCCAACTTCTTAGGCCGTTTCAAGTCCATTCCCAGCATCATTGATCTAGGTAGCTTGAAGGTGACCGGTGATGTATGGTTT
GGATCTAGCGTTACCCTAAAGGGGAAAGTGACTGTTGCAGCCAAATCCGGAGTGAAGCTAGAAATTCCAGATGGTGCTGTGATTGCAAAC
AAGGACATCAATGGACCTGAGGATATATAGAGGAGCTGCTAGTGCCAATTCGATGTCGCGGAGTCTGCAGCAAGTATGTTTGTAGTGAAT
GTAAAATTGTGTCTCTTTAAATAAACGAACAATTTTGCTTGTTTTGTTTAATGGAACCATTGCTACAATACAAATGAAATGACTATATTA
GAGTAACTTGTTCCTTCAAAAAAAAAAAAAAAAAAAAAAAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U143644366 (90.8% of RFLP seq)+
SGN-U143644366 (90.8% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53456)
Chromosome
11
Position
56.77 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51871)
Chromosome
11
Position
17.91 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_11 MQTL_1_Maturity_11 MQTL_2_Late_blight_11 MQTL_2_Maturity_11
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49325)
Chromosome
11
Position
4.91 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47263)
Chromosome
11
Position
50.68 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42312)
Chromosome
11
Position
2.50 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40744)
Chromosome
11
Position
38.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38999)
Chromosome
11
Position
35.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8596)
Chromosome
11
Position
27.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 8598)
Chromosome
11
Position
5.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8597)
Chromosome
11
Position
39.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8595)
Chromosome
11
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8602)
Chromosome
11
Position
39.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT182 was used as an overgo probe on plate 10 [well F2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATGCTGGGAATGGACTTGAAACGG
B sequence
TGGCCAACTTCTTAGGCCGTTTCA
AB sequence
ATGCTGGGAATGGACTTGAAACGGCCTAAG
Marker sequence
TTTTTTTTTTTTTTTTTTTTTTTTTTGAAGGAACAAGTTACTCTAATATA
GTCATTTCATTTGTATTGTAGCAATGGTTCCATTAAACAAAACAAGCAAA
ATTGTTCGTTTATTTAAAGAGACACAATTTTACATTCACTACAAACATAC
TTGCTGCAGACTCCGCGACATCGAATTGGCACTAGCAGCTCCTCTATATA
TCCTCAGGTCCATTGATGTCCTTGTTTGCAATCACAGCACCATCTGGAAT
TTCTAGCTTCACTCCGGATTTGGCTGCAACAGTCACTTTCCCCTTTAGGG
TAACGCTAGATCCAAACCATACATCACCGGTCACCTTCAAGCTACCTAGA
TCAATGATGCTGGGAATGGACTTGAAACGGCCTAAGAAGTTGGCCACCTT
CTT
Genomic location of CT182  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D212 marker 212
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)