SGN Marker solcap_snp_sl_2675

SGN-M21212

Synonyms  
SL1_00sc6004_1752444
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68110)
Chromosome
11
Position
86.03 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64505)
Chromosome
11
Position
103.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57543)
Chromosome
11
Position
51.94 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCGTATGAGACCGAGCTAGGTGCCTCATATACACTCTGGCTGGTGTAGCT
  
3' flanking region
TGTGCCCCTGTATACCTAATTGGTGGAGCCTGATGTGATTGAGGAGGATT
SNP nucleotide
AG
SNPdb format
GCGTATGAGACCGAGCTAGGTGCCTCATATACACTCTGGCTGGTGTAGCT[A/G]
TGTGCCCCTGTATACCTAATTGGTGGAGCCTGATGTGATTGAGGAGGATT
  
Genomic location of solcap_snp_sl_2675  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21212 marker 21212
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)