SGN Marker T1601

SGN-M2122
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.01
Tomato EST read: TPTBN33TH
Arabidopsis best BAC match: AC008148.2
Arabidopsis position: 1.1390000
Arabidopsis identities: 0.723
Best GenBank protein hit: AAD55496.1
Evalue: 5.7e-65
Identities: 0.748
Description: Putative phosphoglucomutase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39700)
Chromosome
5
Position
69.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35607
Forward primer (5'-3')
TGCAACGACGTACAATGAGG
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 700
Solanum pennellii LA716: 800
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GCATATTTACGAGCCGCATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 800
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 72
Forward primer (5'-3')
Unknown
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 700
Solanum pennellii LA716: 800
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Solanum pennellii LA716: 800
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T1601 was used as an overgo probe on plate 12 [well E4]

Plausible BAC Matches:   P033D19,   P131O09,   P121O14,   P252K24,   P325O06,   P260P23,   P330E11,   P304A23,   P272O18,   P251E20,   P021L09

 Overgo Sequences

A sequence
CTGGTTGCATGGTCTTTGACATGG
B sequence
GGTGTTGTTGCAAGTCCCATGTCA
AB sequence
CTGGTTGCATGGTCTTTGACATGGGACTTG
Marker sequence
TGTTCCAATAATAAAGAAACCAAAGTTGCATATTTCCTTGACAAAAACGT
CGATTTCTTCTGTTAGAGTAGTGTGTTGTAGCAGTAGTAGTAGTAGTGCA
ACGACGTACAATGAGGATGAAGAAATGGATAAGATTAGAAGGCTACAAAA
TGGATCGGATGTTCGTGGTGTGGCCTTGCAAGGTGAGAAAGGTAGAAGTG
TAGATCTTACACCACCTGCTGTTGAGGCAATAGCAGAAAGCTTTGGTGAA
TGGGTGATTAAAGGGCTGAACAATAAGGAGAAAGTTGTTATGGTTTCTCT
TGGAAAAGACCCTCGAATTTCGGGCAATACATTGAGTGTTGCTGTATTTT
CTGGTCTTTCTAGGGCTGGTTGCATGGTCTTTGACATGGGACTTGCAACA
ACACCAGCATGCTTCATGAGCACTATTCTTCCTCCATGTCAATATGATGC
CTCAATAATGATGACTGCTTTTCACTTACCCTACACTCGAAATGGTCTTA
AATTCTTCACAAAAAAAGGCGGTTTAACATCCGTGGAAGTGGAGGAAATA
TGCTCAGATGCGGCTCGTAAATATGCAAACAGGTTCGTAAAAG
Genomic location of T1601  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2122 marker 2122
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)