SGN Marker solcap_snp_sl_2686

SGN-M21236

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71767)
Chromosome
11
Position
83.07 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68121)
Chromosome
11
Position
86.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64516)
Chromosome
11
Position
103.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57567)
Chromosome
11
Position
52.01 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TATAGCACGTTCGAAAGTCTTATAGCCCATTTGTGGAGGGTTATTACAAA
  
3' flanking region
TCGCGTAACTTAAACGCGTCACAGAACACCCAAATTCGAATATCGGTCGA
SNP nucleotide
AT
SNPdb format
TATAGCACGTTCGAAAGTCTTATAGCCCATTTGTGGAGGGTTATTACAAA[A/T]
TCGCGTAACTTAAACGCGTCACAGAACACCCAAATTCGAATATCGGTCGA
  
Genomic location of solcap_snp_sl_2686  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21236 marker 21236
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)