SGN Marker solcap_snp_sl_2710

SGN-M21277

Synonyms  
SL1_00sc6004_1958414
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71788)
Chromosome
11
Position
84.17 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68133)
Chromosome
11
Position
88.58 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57608)
Chromosome
11
Position
52.14 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCCAACAAATTCTCCTACGCCATTGTAGTCGTGGGAGAAGTCCCATACGC
  
3' flanking region
GAGATGTTTGGCGATAGCTCAAACCTTACTATAACTGAACCCGGCCCTAG
SNP nucleotide
AG
SNPdb format
TCCAACAAATTCTCCTACGCCATTGTAGTCGTGGGAGAAGTCCCATACGC[A/G]
GAGATGTTTGGCGATAGCTCAAACCTTACTATAACTGAACCCGGCCCTAG
  
Genomic location of solcap_snp_sl_2710  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21277 marker 21277
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)