SGN Marker solcap_snp_sl_27107

SGN-M21279

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57610)
Chromosome
3
Position
8.75 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTTCCACAGCCCGTCCAATATGTTCAGCATGCAGGCAGTGTTAATCCTC
  
3' flanking region
ACTGCAGCAGCAGCAACAACAACAAGAAACAATGCAGCAGACAATTCATC
SNP nucleotide
AT
SNPdb format
GTTTCCACAGCCCGTCCAATATGTTCAGCATGCAGGCAGTGTTAATCCTC[A/T]
ACTGCAGCAGCAGCAACAACAACAAGAAACAATGCAGCAGACAATTCATC
  
Genomic location of solcap_snp_sl_27107  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21279 marker 21279
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)