SGN Marker T1607

SGN-M2128
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.11.03
Tomato EST read: TPTBN62TH
Arabidopsis best BAC match: AC002334.2
Arabidopsis position: 2.1860000
Arabidopsis identities: 0.924
Best GenBank protein hit: BAA03526.1
Evalue: 1.4e-64
Identities: 0.837
Description: F1-ATPase gammma subunit [Ipomoea batatas]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39702)
Chromosome
3
Position
105.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1607 was used as an overgo probe on plate 2 [well H12]

Plausible BAC Matches:   P158O09,   P251F10,   P233O20

 Non-Plausible BAC matches

P138L01,   P201C17,   P187G12,   P280I15,   P270H08

 Overgo Sequences

A sequence
CCACACCTCTGATTTCTCCCAATC
B sequence
CGAAAAACAGTGGCAGGATTGGGA
AB sequence
CCACACCTCTGATTTCTCCCAATCCTGCCA
Marker sequence
GGTTTCAAGCGACTGTAAATCCTAGCGTAAATTTGTCGATCTGCGAAGAG
GATAAGCCGGAGGGGGAAGGTGCCGATCAGATCGAATCGGATCAACAATG
GCCATGGCTGCGTTGAGGCGTGAGGGAAGGCGTTTCGCCACACCTCTGAT
TTCTCCCAATCCTGCCACTGTTTTTCGTTCTTCAATCATTCCTTCTGAGG
AACCAGTCTTGTCAGGAGTTCGATGTATTTCAACTCAAGTTGTCAGAAAC
CGGATGAAGAGTGTCAAAAATATTCAGAAGATTACGAAGGCTATGAAGAT
GGTTGCTGCTTCAAAGCTCAGAGCTATTCAAACTAGAGCTGAAAATTCAC
GCGGCCTGTGGCAGCCATTTACTGCCCTTCTTGGTGACACTCCTAGTATT
GATGTCAAGAAGAATGTTATTGTTACCATTTGCGCAGACAAAGGTCTTTG
CGGTGGAATCAATTCTACATCTGTCAAGATAAGCAGGGCTATGCATAAGT
TGAATTCTGGTCCTGATAAGGAAAATAAGTATGTTGTCTTGGGGGAAAAG
GCAAA
Genomic location of T1607  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2128 marker 2128
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)