SGN Marker solcap_snp_sl_27113

SGN-M21282

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71791)
Chromosome
3
Position
36.63 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68136)
Chromosome
3
Position
39.70 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64529)
Chromosome
3
Position
41.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57613)
Chromosome
3
Position
8.78 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTGATTTGGAATTCTGCTGTGGTGGAGGCATATGGGGAGAAGTCTTTGGG
  
3' flanking region
GGATTAAAGGTGGAAAATGTGGTTACTGGAGAGGTATCAGATTTGGAGGT
SNP nucleotide
TG
SNPdb format
GTGATTTGGAATTCTGCTGTGGTGGAGGCATATGGGGAGAAGTCTTTGGG[T/G]
GGATTAAAGGTGGAAAATGTGGTTACTGGAGAGGTATCAGATTTGGAGGT
  
Genomic location of solcap_snp_sl_27113  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21282 marker 21282
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)