SGN Marker T1608

SGN-M2129
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTBN63TH
Arabidopsis best BAC match: AL391150.1
Arabidopsis position: 5.0254000
Arabidopsis identities: 0.802
Best GenBank protein hit: CAC01895.1
Evalue: 2.1e-53
Identities: 0.796
Description: glutamine-rich protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39703)
Chromosome
3
Position
73.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1608 was used as an overgo probe on plate 9 [well D4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTGAAGATGCCTGCGAAAGGCTTC
B sequence
ACCACATGGTAAGGCAGAAGCCTT
AB sequence
TTGAAGATGCCTGCGAAAGGCTTCTGCCTT
Marker sequence
GGTTCATCTCCGTCCTCATTTGCTCTTTCATCGCCCCCTTACCCGTCTTC
AATCACAGAACCCGAATTCAAACCCTAACCCTAACCCTAGCTCTAGCAAT
AATCCGTCAAGCCAGATCCCCAATCTACAAAACCCGGGTACTTCCCAACA
ACAACAACAGCAGCAGCAGCAGCAGAAGTTGACACGGGTTGCCCCGGAAT
CGAACCGGGTGGAGCTCCAGATGGCTTACCACGACGCTTGGCGAGTTTGC
CATCCTGATTTTAAGCGTGCTTTCTCTTCTCTTGAAGATGCCTGCGAAAG
GCTTCTGCCTTACCATGTGGTGGCAGACTATGAAGCAGAGGAGGATGATA
AGATCCTCGATTCAGACACTAGTGGCCAAATGCTCTCTCGTTCACAGCAG
TGGGATCACAACATTGCTGTGAAAGTTTCAGAGTTTACTGCAACATTTGA
GAAACAAGTGCTTGCGTTTAATATAATTTCCCGCAAGAGAGATGTTGGAG
AATTCCGTACCGAGGAGAAACTGATGTTAGAGCAGTCACTGTTGCAAGAA
GAGAGGAAAAGCCTGCTTGAAT
Genomic location of T1608  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2129 marker 2129
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)