SGN Marker solcap_snp_sl_27167

SGN-M21291

Synonyms  
Le019218_58
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71798)
Chromosome
4
Position
33.85 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68143)
Chromosome
4
Position
45.57 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57622)
Chromosome
4
Position
4.83 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GATCGAAGGTCAATTGAGAGAAGCAGAAGAGACTATGACAGGAGCAGGAG
  
3' flanking region
CGTAGTAGGAGTAGAAGCCACAGCCGAAGCTTGCATGATCAAGGTACAAG
SNP nucleotide
CG
SNPdb format
GATCGAAGGTCAATTGAGAGAAGCAGAAGAGACTATGACAGGAGCAGGAG[C/G]
CGTAGTAGGAGTAGAAGCCACAGCCGAAGCTTGCATGATCAAGGTACAAG
  
Genomic location of solcap_snp_sl_27167  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21291 marker 21291
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)