SGN Marker solcap_snp_sl_27230

SGN-M21297

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71800)
Chromosome
3
Position
45.97 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57628)
Chromosome
3
Position
43.89 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGTATCTTCAATTGTTTCATCACTTTCTCCCTGTGTTATAAGGCCATTAG
  
3' flanking region
GATCCATAGTTGAACAACCTCGTCACGACCAAAGGGGTGATCTTTAGGAA
SNP nucleotide
TC
SNPdb format
TGTATCTTCAATTGTTTCATCACTTTCTCCCTGTGTTATAAGGCCATTAG[T/C]
GATCCATAGTTGAACAACCTCGTCACGACCAAAGGGGTGATCTTTAGGAA
  
Genomic location of solcap_snp_sl_27230  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21297 marker 21297
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)