SGN Marker solcap_snp_sl_27556

SGN-M21318

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71815)
Chromosome
1
Position
68.96 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57649)
Chromosome
1
Position
74.64 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGTGGCAGCGGAACTTAAAGAATTGGAGATTCTGGATTCAAATCCTTCTC
  
3' flanking region
CCCCCGTGAGTTCAAAAGGAATTATCATTTTGTCTTATCTGGAGATGGCC
SNP nucleotide
AG
SNPdb format
TGTGGCAGCGGAACTTAAAGAATTGGAGATTCTGGATTCAAATCCTTCTC[A/G]
CCCCCGTGAGTTCAAAAGGAATTATCATTTTGTCTTATCTGGAGATGGCC
  
Genomic location of solcap_snp_sl_27556  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21318 marker 21318
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)