SGN Marker T1612

SGN-M2133
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTBN73TH
Arabidopsis best BAC match: AL163812.1
Arabidopsis position: 5.0172600
Arabidopsis identities: 0.752
Best GenBank protein hit: BAB01044.1
Evalue: 4.1e-69
Identities: 0.693
Description: contains similarity to diaminopimelate decarboxylase~gene_id:MLN21.17 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39705)
Chromosome
1
Position
150.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1612 was used as an overgo probe on plate 8 [well D7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATTCCAACAATGGCGGCTACACAC
B sequence
GAGAGTGTGAGACAAGGTGTGTAG
AB sequence
ATTCCAACAATGGCGGCTACACACCTTGTC
Marker sequence
GGTCTAAAAGCCTTTTGGTATCTTTATTCCAACAATGGCGGCTACACACC
TTGTCTCACACTCTCCATCACTTCACAAGTCCCTCAAATACCCATCAAAT
GCATCACAAAAACTTTCTTTTTTCAAACCCAATTTTCCATTGAAGCCCAT
CTCAAGAAACCTTAGCATAAGGGCATCTGTATCAACTTCTGAGCCTCAAA
CTCAGAAATTTCAGCATTGTTTCAAGAAATCTGAAGATGGGTTTTTGTAT
TGTGAGGGTGTTAAGGTTGAAGATGTTATGGAGACTGTCGAAAGACGACC
CTTTTATTTATATAGTAAGCCCCAAATTACTAGGAACGTTGAGGGCTATA
AGGCCGCTTTAGAGGGTTTGGATTCAATTATTGGTTATGCTATTAAGGCC
AATAATAATCTAAAGATTTTGGAACATTTGAGGAGCCTTGGTTGTGGAGC
TGTTTTGGTTAGTGGGAATGAACTCAAATTGGCACTTGGTGCTGGATTTG
ATCCTACGAAGTGTATTTTTAATGGAAATGGAAAGCTGTTAGAGGACCTA
GTGCTAGCTGCCCAAGCAGGTGTGTTTGTAAACATCGACAGTGAATTTGA
CTGGGATAACATTG
Genomic location of T1612  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2133 marker 2133
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)