SGN Marker solcap_snp_sl_28023

SGN-M21348

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71832)
Chromosome
1
Position
84.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68158)
Chromosome
1
Position
70.71 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64549)
Chromosome
1
Position
116.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57679)
Chromosome
1
Position
78.58 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACATTGGTTATGTAGACGAGGTAATGCGCAAAGTTGAGCTGGAAGAATTC
  
3' flanking region
AAAGAGCATCTGGATTGGGTTTGAAGGTGAAATTGTTTGACACAACCTTA
SNP nucleotide
AG
SNPdb format
ACATTGGTTATGTAGACGAGGTAATGCGCAAAGTTGAGCTGGAAGAATTC[A/G]
AAAGAGCATCTGGATTGGGTTTGAAGGTGAAATTGTTTGACACAACCTTA
  
Genomic location of solcap_snp_sl_28023  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21348 marker 21348
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)