SGN Marker solcap_snp_sl_28247

SGN-M21359

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71841)
Chromosome
1
Position
87.63 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68165)
Chromosome
1
Position
76.39 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64556)
Chromosome
1
Position
121.53 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57690)
Chromosome
1
Position
79.46 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCCTTCAACAACATTACAAGGCTTGCATTTGGGAAGAGGTTTGAAAACTT
  
3' flanking region
GAAGGTGTAATTGATGAACAAGGAAATGAGTTCAAGGCGATTGTTGCCAA
SNP nucleotide
TC
SNPdb format
GCCTTCAACAACATTACAAGGCTTGCATTTGGGAAGAGGTTTGAAAACTT[T/C]
GAAGGTGTAATTGATGAACAAGGAAATGAGTTCAAGGCGATTGTTGCCAA
  
Genomic location of solcap_snp_sl_28247  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21359 marker 21359
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)