SGN Marker T1616

SGN-M2137
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZAA06TH
Arabidopsis best BAC match: AC013483.5
Arabidopsis position: 3.0121000
Arabidopsis identities: 0.614
Best GenBank protein hit: AAF21211.1
Evalue: 1.3e-97
Identities: 0.708
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39706)
Chromosome
2
Position
1.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35608
Forward primer (5'-3')
TTGGAAGAAGAGGAGGACGA
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 1500
Solanum pennellii LA716: 600+900
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CCCAGAAAGATCCAAGTCCA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 21
Forward primer (5'-3')
Unknown
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 1500
Solanum pennellii LA716: 600+900
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T1616 was used as an overgo probe on plate 10 [well F3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P077A20,   P056M16,   P003G15,   P185B20,   P315G02,   P036D11,   P310P20,   P120C02,   P155E05,   P302G13,   P312G03,   P210J05,   P305C06,   P281L05,   P223A02

 Overgo Sequences

A sequence
GCAACGAACTTGCCATCAAACCTG
B sequence
CACCGTTTGCTAGGAACAGGTTTG
AB sequence
GCAACGAACTTGCCATCAAACCTGTTCCTA
Marker sequence
GATTCCCCTTTAAATCAGTTGCAATATGTTTACCAAAATGTAAGGTGAAG
TCTGTTCATATTCCATCAGTTTCTGAAGCTTCTTCTATTTCATCTACTAA
TTTGGAAGAAGAGGAGGACGACGATCCCACTGCTGAACTTGTTTATCTTG
ACCCTGAAATTGATCCTGAGAGCTTATCTGAGTGGGAATTGGATTTTTGT
TCAAGACCAATTCTTGATATTAGAGGGAAAAAATTATGGGAGCTTCTTGT
TTGTGATGATTCCCTCTCTCTTCAGTATACCAAATATTTTCCTAATAATC
TTATCAATAGTATCACTTTGAAAGATGCTTTACTATCTATATCTAATGAC
TTAGGTATCCCATTACCCGATAAAATCAGATTCTTCAGGTCACAAATGCA
AACTATTATTACAAGAGCTTGCAACGAACTTGCCATCAAACCTGTTCCTA
GCAAACGGTGCTTATCACTTGTCCTTTGGCTTGAAGACCGCTATGAAACT
GTTTATACTCGCCATCCTGGTTTTCAAAAAGGAGCCAAGCCACTTCTTGC
ACTTGACAATCCTTTTCCAATGGAACTTCCTGAGAATCTGTATGGAGAAA
AGTGGGCTTTTGTCCAGTTGCCCGTTTCAGCTGTTCGTAAGGAAGTATCT
AACCTGGAGACTAGGTTGGTTTTTGGCTCAAGTTTGGACTTGGATCTTTC
TGGGATCGAAATTGAAGACAACACATTGATTCCTGGACTAGC
Genomic location of T1616  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2137 marker 2137
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)