SGN Marker solcap_snp_sl_28471

SGN-M21389

Synonyms  
SL1_00sc6004_2482563
SL1_00sc6004_2482563_solcap_snp_sl_28471
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70600)
Chromosome
11
Position
89.66 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57720)
Chromosome
11
Position
52.67 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTCAAGAAATGCCATCGGGGATTTCAAAACGCCCACGACTTAAGACCTT
  
3' flanking region
ATTGCCTCAACATCTTTACATTTTCTCTAAATCTATTTCTATCCTGCAAC
SNP nucleotide
TG
SNPdb format
ATTCAAGAAATGCCATCGGGGATTTCAAAACGCCCACGACTTAAGACCTT[T/G]
ATTGCCTCAACATCTTTACATTTTCTCTAAATCTATTTCTATCCTGCAAC
  
Genomic location of solcap_snp_sl_28471  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21389 marker 21389
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)