SGN Marker T1619

SGN-M2139
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TRZAA37TV
Arabidopsis best BAC match: AC005770.2
Arabidopsis position: 2.2110000
Arabidopsis identities: 0.637
Best GenBank protein hit: CAA70174.1
Evalue: 3.7e-43
Identities: 0.720
Description: osr40g2 [Oryza sativa]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49464)
Chromosome
1
Position
5.78 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47398)
Chromosome
1
Position
36.19 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39708)
Chromosome
1
Position
29.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1619 was used as an overgo probe on plate 8 [well E11]

Plausible BAC Matches:   P003D15

 Overgo Sequences

A sequence
GAAGCGAACGATCTTCCAGTGTTG
B sequence
AGGAGACAACAGGAACCAACACTG
AB sequence
GAAGCGAACGATCTTCCAGTGTTGGTTCCT
Marker sequence
GAAAGTAATATATTTTGACATTCAAAATACATTCAACAACACAACTCATC
AAACAAGCTTTTATAAATATAAGTTGAACAGACATGCTGTAGCCAACATC
TCCACAATATACATAGCATTTCCCCTCTTATTTTAATGTTACTTCTTACT
GTTTTGGAGGGACATACAATACAGTACAACATAGGTAACAAGCCACATGA
TGAAAGAAAAATACCACGCATCAACCCAATTCCAGCCATGATTCACAAGC
CAACATATCAGAAGCGAACGATCTTCCAGTGTTGGTTCCTGTTGTCTCCT
TTCCACCATTCCCAAAGACAAACAGTGGTCCCATCGCGGACACCTCCATG
CTCTTTATCAGCATTCCATGCATCTAGATTGAGGTTAATGTTATTGACCA
TCCTAACTGCTCGATAACCATCACCCACATCCCTGCTCTCTGTCCATAAG
ATTGATGCATCAAGAACGTCGGGATTGTATGGGGTGAGCTGCACAGGGTG
AGAGGCGCCAATAGAGTGCTTCACTGCCAGTCCTGAAGCTTTATTAACCA
AAGCAAAGCTTGGAAATCCCTCTTCATCCTTCACTTTAGTACTGAACTT
Genomic location of T1619  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2139 marker 2139
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)